atcc 49456 t Search Results


s mitis atcc 49456  (ATCC)
99
ATCC s mitis atcc 49456
S Mitis Atcc 49456, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Streptococcus+mitis+Andrewes+and+Horder+emend%2E+Judicial+Commission/10__1128_slash_aem__02950___19-152-26-28
Average 99 stars, based on 1 article reviews
s mitis atcc 49456 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
atcc 49455t  (ATCC)
93
ATCC atcc 49455t
Atcc 49455t, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Yokenella+regensburgei+Kosako+et+al/10__1128_slash_mra__00104___20-10-23-23
Average 93 stars, based on 1 article reviews
atcc 49455t - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
streptococcus sanguinis  (ATCC)
96
ATCC streptococcus sanguinis
Streptococcus Sanguinis, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Streptococcus+sanguinis/10__5897_slash_ajb2015__14714-67-13-15
Average 96 stars, based on 1 article reviews
streptococcus sanguinis - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
streptococcus mitis atcc 49456  (ATCC)
96
ATCC streptococcus mitis atcc 49456
Streptococcus Mitis Atcc 49456, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Streptococcus+mitis%3B+Strain+NS+51/10__1590_slash_1807___2577__11015-55-18-20
Average 96 stars, based on 1 article reviews
streptococcus mitis atcc 49456 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
49455t  (ATCC)
90
ATCC 49455t
49455t, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/yWXD7044/10__1128_slash_mra__00104___20-46-12-11
Average 90 stars, based on 1 article reviews
49455t - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
phosphoglucomutase gene  (ATCC)
94
ATCC phosphoglucomutase gene
Bacterial strains and primers used in the study
Phosphoglucomutase Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Nigrospora+sphaerica+(Saccardo)+Mason%2C+anamorph/pmc03318478-215-70-81
Average 94 stars, based on 1 article reviews
phosphoglucomutase gene - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier
actinomadura fibrosa atcc 49459t  (ATCC)
93
ATCC actinomadura fibrosa atcc 49459t
Bacterial strains and primers used in the study
Actinomadura Fibrosa Atcc 49459t, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Actinomadura+fibrosa/pm20042751-97-49-51
Average 93 stars, based on 1 article reviews
actinomadura fibrosa atcc 49459t - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
oral streptococci s mitis atcc 49456  (ATCC)
95
ATCC oral streptococci s mitis atcc 49456
Bacterial strains and primers used in the study
Oral Streptococci S Mitis Atcc 49456, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Eikenella+corrodens%3B+Strain+333%2F54-55/pm22371122-92-0-4
Average 95 stars, based on 1 article reviews
oral streptococci s mitis atcc 49456 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier
oral pathogens  (ATCC)
97
ATCC oral pathogens
Bacterial strains and primers used in the study
Oral Pathogens, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Streptococcus+mutans/pm23578062-7-30-34
Average 97 stars, based on 1 article reviews
oral pathogens - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier
streptococcus mitis  (ATCC)
99
ATCC streptococcus mitis
Bacterial strains and primers used in the study
Streptococcus Mitis, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Streptococcus+mutans/10__1590_slash_s2175___97902019000418371-89-12-14
Average 99 stars, based on 1 article reviews
streptococcus mitis - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier
strains s pseudopneumoniae atcc baa 960t  (ATCC)
96
ATCC strains s pseudopneumoniae atcc baa 960t
Bacterial strains and primers used in the study
Strains S Pseudopneumoniae Atcc Baa 960t, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Akkermansia+ignis%3B+Strain%3A+MmAkk3/10__1128_slash_jcm__42__10__4686___4696__2004-116-3-6
Average 96 stars, based on 1 article reviews
strains s pseudopneumoniae atcc baa 960t - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
r001t  (ATCC)
94
ATCC r001t
Bacterial strains and primers used in the study
R001t, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/atcc+49456+t/Staphylococcus+saprophyticus+(Fairbrother)+Shaw+et+al/pm15023939-119-4-5
Average 94 stars, based on 1 article reviews
r001t - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results


Bacterial strains and primers used in the study

Journal: Journal of Bacteriology

Article Title: Effect of Periodontal Pathogens on the Metatranscriptome of a Healthy Multispecies Biofilm Model

doi: 10.1128/JB.06328-11

Figure Lengend Snippet: Bacterial strains and primers used in the study

Article Snippet: DNA was extracted as described above. table ft1 table-wrap mode="anchored" t5 caption a7 Bacterial strain or RT-qPCR primer Forward primer 5′–3′ Reverse primer 5′–3′ Target gene (source or reference) Bacterial strains Actinomyces naeslundii (MG1) GAGAAGAACTCCCTATCCATACC CTTCATGGGTTGGGATTTCCT Target is fimA gene, a fimbrial protein (this work) Fusobacterium nucleatum (ATCC10953) CTTATACATAGAGGACACAGAC TTTCCAACAACATCTCCCTG HprK gene ( 30 ) homologue of HPr kinase/phosphorylase (this work) Lactobacillus casei (ATCC 334) TGAATATTTACACGGTTCGGCA GGGCCTTAGTTTCATCCGAC Target is the phosphoglucomutase gene ( 10 ) (this work) Streptococcus mitis (NCTC 12261, ATCC 49456) CGTATCGGTCGTCTTGCT TTGCATAACTGGATCTGTAAGGTC Target is the glyceraldehyde-3-phosphate gene (this work) Veillonella parvula (ATCC17745) ACAGTTACTTTATAGTCTGTACC TGGTCAATTGGCTAAACGTCAA Target is the chaperone dnaK gene ( 29 ) (this work) Aggregatibacter actinomycetemcomitans (HK1651) ACGCAGACGATTGACTGAATTTAA GATCTTCACAGCTATATGGCAGCTA Target is lktC gene part of the leukotoxin operon lktBAC ( 54 ) Porphyromonas gingivalis (ATCC 33277) CCTACGTGTACGGACAGAGCTATA AGGATCGCTCAGCGTAGCATT Target is the Arg-gingipain gene ( 54 ) RT-qPCR primers Universal CGCTAGTAATCGTGGATCAGAATG TGTGACGGGCGGTGTGTA 16S rRNA ( 79 ) Actinomyces naeslundii (MG1) ATCTCCAAGGTTCTGCACGACGAGTA ATGTTGATGGTGATACCGCGCTGA ANA_0022 (this work) Aggregatibacter actinomycetemcomitans (HK1651) AAGAACTTAACGCTTGGGCGATGC TAACGCTTCTTGTGCAACACTGGC AA00470 (this work) Veillonella parvula (ATCC17745) AAAGCCTTGGGCCATTCTCTGTTG CCAAGGCCTCTTGTTCTTGCATCA HMPREF1035_1004 (this work) Porphyromonas gingivalis (ATCC 33277) AGAAAGCCAGCCATTGTTGCATGG TGTTCGGGACACCTGACTGTTCAT PGN_0074 (this work) Open in a separate window Bacterial strains and primers used in the study Doubling time was calculated using the following formula: t d = ( t 2 − t 1 ) × log (2)/log( q 2 / q 1 ), where q 2 represents the final number of cells, q 1 represents the initial number of cells added, and ( t 2 − t 1 ) represents the interval of incubation.

Techniques: